Fasta format example

Sequence Format
Fasta: A common sequence format offered by most sequence and alignment editors.
Format: A 'greater than' symbol followed by the sequence name. The following line is the sequence.
Example:
>LOC_Os01g03950.1
ATGCGAGAAATGCTGGCGTCTCTCTCTTCTTCGTCCCGTGCGGCCATCTCCTGCATCCCGTTGTGTCTCCTCTTCCTGACCTTGGCGAGCAGCAAT GGCGTGTTTGCCGCAGCACCACCCAAGGTTGGGTCCGGGTACAAGCTTGTGTCCCTGGTCGAGCACCCCGAGGGAGGAGCTCTCGTTGGATACCTGCAGG TGAAGCAGCGCACCTCCACCTACGGCCCGGACATCCCTCTCCTCAGGCTCTATGTCAAGCACGAGACCAAGGACAGGATACGAGTCCAGATCACGGACGC AGACAAGCCGAGGTGGGAGGTCCCCTACAACCTTCTCCAGAGGGAGCCAGCCCCGCCCGTCACCGGCGGGAGGATCACCGGCGTGCCCTTCGCCGCCGGC GAGTACCCGGGTGAGGAGCTCGTGTTCACCTACGGCCGCGACCCGTTCTGGTTCGCGGTGCACCGGAAGTCCAGCCGCGAGGCGCTCTTCAACACCAGCT GCGGCGCGCTGGTGTTCAAGGACCAGTACATCGAGGCGTCGACGTCGCTGCCCAGGGACGCGGCGCTGTACGGCCTCGGCGAGAACACGCAGCCGGGCGG CATCCGGCTGCGCCCCAACGACCCGTACACCATCTACACCACGGACATCTCGGCGATCAACCTCAACACCGACCTCTACGGCTCGCACCCGGTGTACGTG GACCTCAGGAGCCGTGGCGGCCATGGCGTCGCGCACGCCGTGCTGCTGCTGAACAGCAACGGCATGGACGTGTTCTACAGGGGGACGTCGCTGACGTACA AGGTCATCGGTGGCCTCCTCGATTTCTACCTCTTCTCCGGGCCGACGCCGTTGGCCGTGGTGGATCAGTACACGTCCATGATCGGACGACCAGCCCCAAT GCCGTACTGGGCATTTGGGTTCCACCAATGCAGATGGGGATACAAGAACTTGTCAGTGGTCGAGGGCGTCGTGGAGGGCTACCGGAACGCGCAAATCCCC CTCGACGTGATCTGGAACGACGACGATCACATGGACGCCGCGAAGGATTTCACCCTTGATCCCGTGAACTACCCGCGTCCCAAGCTGCTGGAATTCCTTG ACAAGATCCATGCACAGGGCATGAAGTACATTGTCCTCATCGACCCCGGCATCGCCGTGAACAACACCTATGGCGTGTACCAGCGCGGCATGCAGGGCGA CGTCTTCATCAAGCTGGACGGGAAGCCATACCTGGCGCAGGTGTGGCCCGGCCCCGTCTACTTCCCGGACTTCCTCAACCCCAATGGCGTCTCGTGGTGG ATCGACGAGGTGAGGAGGTTTCATGACCTTGTGCCCGTGGATGGCCTCTGGATCGACATGAACGAGGCATCCAACTTCTGCACCGGGAAATGCGAGATCC CGACGACGCACCTGTGCCCTCTGCCCAACACGACGACGCCATGGGTGTGCTGCTTGGACTGCAAGAACCTGACGAACACCAGGTGGGACGAGCCGCCGTA CAAGATCAACGCCTCCGGCCAGACGGCGCGGCTCGGCTTCAACACCATCGCCACCAGCGCGACGCACTACAATGGCATCCTGGAGTACAATGCGCACAGC CTGTATGGATTCTCGCAGGCCATCGCGACGCACCAGGCGCTGCAGGGGCTCCAGGGCAAGCGGCCGTTCATCCTGACGCGCTCTACGTTCGTCGGGTCGG GCGCCTACGCCGCGCACTGGACCGGCGACAACAAGGGCACCTGGGAGAATCTCCGCTACTCCATCTCCACCATGCTCAACTTCGGCATCTTCGGCATGCC GATGGTCGGCGCCGACATCTGCGGGTTCTACCCGCAGCCGACGGAGGAGCTCTGCAACCGGTGGATCGAGCTCGGCGCGTTCTACCCGTTCTCCAGGGAC CATGCCAACTTCGCGTCGCCGAGGCAGGAGCTGTATGTGTGGGAGTCCGTGGCCAAGTCGGCTCGGAACGCGCTCGGCATGCGGTACAGGCTGCTCCCTT ACCTGTACACGCTCAACTACCAGGCGCATCTCACCGGCGCTCCGGTGGCGCGGCCGGTGTTCTTCTCGTTCCCGGACTTCACGCCGTGCTACGGGCTGAG CACGCAGTACCTGCTCGGCGCGAGCGTCATGGTGTCGCCGGTGCTCGAGCAGGGCGCCACCTCGGTGAGCGCCATGTTCCCGCCGGGGAGCTGGTACAAC CTGTTCGACACGACCAAGGTGGTGGTGTCCAGGGGCGAGGGCGCCGTGAAGCTGGACGCGCCGCTCAACGAGATCAACGTGCACGTGTTCCAGAACACGA TCCTCCCGATGCAGCGCGGCGGGACGATCTCCAAGGAGGCCCGCGCGACGCCGTTCACGCTGGTGGTCGCGTTCCCGTTCGGCGCCACCGAGGCGGAGGC CGAGGGCGCCGTGTACGTCGACGACGACGAGCGGCCGGAGATGGTGCTCGCGGAGGGGCAGGCGACGTACGTCCGCTTCTACGCGACGGTGCGCGGCAAG GCGGTGACGGTGAGGTCGGAGGTGGAGCTAGGCAGCTACAGCTTGCAGAAGGGGCTCCTCATCGAGAAGCTGTCCGTGCTCGGACTGGAGGGAACAGGCA GGGACCTCGCCGTCCATGTCGATGGCGCGAACGCCACCGCCATTGCAACGTCGAGGCCGTACTTTGCAGGTGCCGAGGCGGAGCTGCACGGGCACCGCGA CGTGGAGGGACACAAGAAGAGCGTGATGGTGGAGGTGGGAGGGCTGGCATTGCCGCTGGGCAAGAGCTTCACCATGACTTGGAACATGCAGATCGAAGCATAG